Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-25875095

Morpholino Name: dach1 MO1
Synonyms:
Target mRNA: dach1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGATCGGGGAGGCAGTCGTATGCGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genome
MO
5' TCGCATACGACTGCCTCCCCGAGGT 3'
   ||||||||||||||||||||||  |
3' AGCGTATGCTGACGGAGGGGCTAGA 5'
5' TCGCATACGACTGCCTCCCCGATCT 3'
   |||||||||||||||||||||||||
3' AGCGTATGCTGACGGAGGGGCTAGA 5'
5' TCGCATACGACTGCCTCCCCGATCT 3'
   |||||||||||||||||||||||||
3' AGCGTATGCTGACGGAGGGGCTAGA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:133167312..133167336 25/25 Sense target dach1.L
Chr2S:118522111..118522135 25/25 Sense target dach1.S
tropicalis 10.0 Chr2:127498639..127498663 23/25 Sense target dach1
Publications
First: Dach1 regulates neural crest migration during embryonic development., Biochem Biophys Res Commun 2020          
Most recent:
View All Papers