Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-25874751

Morpholino Name: fbl MO1
Synonyms: fibrillarin MO
Target mRNA: fbl

Morpholino Type: uncategorized morpholino
Sequence: 5' AGATCGAGCAGGAGAATCGCAGCGC 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 24/25 25/25
genome
MO
5' GCGCTGCGATTCTCCTGCACGATCT 3'
   |||||||||||||||||| ||||||
3' CGCGACGCTAAGAGGACGAGCTAGA 5'
5' GCGCTGCGATTCTCCTGCTCGATCT 3'
   |||||||||||||||||||||||||
3' CGCGACGCTAAGAGGACGAGCTAGA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:107778961..107778985 25/25 Sense target fbl.S
Chr7L:131292579..131292603 24/25 Sense target fbl.L
Chr4S:12932927..12932951 21/25 Sense off-target shank2.S
Publications
First: Systematic mapping of rRNA 2'-O methylation during frog development and involvement of the methyltransferase Fibrillarin in eye and craniofacial development in Xenopus laevis., PLoS Genet 2022                                                                
Most recent:
View All Papers