Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-25874504

gRNA Name: rho gRNA2
Synonyms: rhosg4
Genomic Target: rho

Sequence: 5' GGGTGGTGATCAAGCAGTTA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genome
gRNA
5' TAACTGCTTGATCACCACCC 3'
   ||||||||||||||||||||
3' ATTGACGAACTAGTGGTGGG 5'
5' TAACTGCTTGATCACCACCC 3'
   ||||||||||||||||||||
3' ATTGACGAACTAGTGGTGGG 5'
5' TAACTGCTTGATCACCACCC 3'
   ||||||||||||||||||||
3' ATTGACGAACTAGTGGTGGG 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:126166046..126166065 20/20 Antisense target rho.L
chr4S:104517148..104517167 20/20 Antisense target rho.S
chr4L:126153607..126153626 20/20 Antisense off-target rho.2.L
chr1L:139283420..139283439 16/20 Antisense off-target LOC101027262
chr1L:47187221..47187240 18/20 Sense unknown
chr5S:94214157..94214176 18/20 Antisense unknown
chr7S:62152195..62152214 17/20 Sense unknown
tropicalis 10.0 Chr4:131926665..131926684 20/20 Antisense target rho
Chr2:45190338..45190357 16/20 Antisense off-target adgrg2
Chr7:59306211..59306230 16/20 Antisense off-target LOC100486241
Chr7:115892551..115892570 19/20 Antisense unknown
Chr2:179739929..179739948 17/20 Sense unknown
Publications
First: Modeling Dominant and Recessive Forms of Retinitis Pigmentosa by Editing Three Rhodopsin-Encoding Genes in Xenopus Laevis Using Crispr/Cas9., Sci Rep 2017                
Most recent:
View All Papers