Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-25874503

gRNA Name: rho.2 gRNA1
Synonyms: rhosg3
Genomic Target: rho.2

Sequence: 5' GGGACCCTCTGTTCCGTTCA 3'



Genomic Target laevis.L
Identities 18/20
genome
gRNA
5' TGAACGGAACAGAAGGTCCA 3'
   ||||||||||||| ||||| 
3' ACTTGCCTTGTCTCCCAGGG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:126150868..126150887 18/20 Antisense target rho.2.L
chr4L:126162924..126162943 20/20 Antisense off-target rho.L
chr4S:104514217..104514236 18/20 Antisense off-target rho.S
tropicalis 10.0 Chr4:131923484..131923503 18/20 Antisense off-target rho
Publications
First: Modeling Dominant and Recessive Forms of Retinitis Pigmentosa by Editing Three Rhodopsin-Encoding Genes in Xenopus Laevis Using Crispr/Cas9., Sci Rep 2017                
Most recent:
View All Papers