Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-25874502

gRNA Name: rho gRNA1
Synonyms: rhosg1
Genomic Target: rho

Sequence: 5' GGCTCTGCTAAGTAATACTG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genome
gRNA
5' CAGTATTACTTAGCAGAGCC 3'
   ||||||||||||||||||||
3' GTCATAATGAATCGTCTCGG 5'
5' CAGTATTACTTAGCAGAGCC 3'
   ||||||||||||||||||||
3' GTCATAATGAATCGTCTCGG 5'
5' CAGTATTACTTAGCAGAGCC 3'
   ||||||||||||||||||||
3' GTCATAATGAATCGTCTCGG 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:126163004..126163023 20/20 Antisense target rho.L
chr4S:104514297..104514316 20/20 Antisense target rho.S
chr4L:126150948..126150967 20/20 Antisense off-target rho.2.L
chr1S:91294794..91294813 17/20 Antisense off-target ssbp4.S
chr2S:81103144..81103163 17/20 Antisense off-target caln1.S
chr6S:24255818..24255837 17/20 Sense off-target ankib1.S
chr6L:50144370..50144389 16/20 Sense off-target nek11.L
chr7L:11263863..11263882 16/20 Sense off-target LOC108696078 [provisional:ank3]
Scaffold92608:176..195 20/20 Sense unknown
chr3S:66376897..66376916 18/20 Sense unknown
chr1S:18397657..18397676 16/20 Sense unknown
tropicalis 10.0 Chr4:131923564..131923583 20/20 Antisense target rho
Chr5:54024086..54024105 18/20 Antisense off-target pacrg
Chr3:37428736..37428755 17/20 Antisense off-target ndfip1
Chr6:31662506..31662525 17/20 Sense off-target ankib1
Chr3:131561206..131561225 19/20 Sense unknown
Chr4:115356748..115356767 18/20 Sense unknown
Chr3:36678532..36678551 17/20 Sense unknown
Chr7:24070294..24070313 16/20 Antisense unknown
Publications
First: Modeling Dominant and Recessive Forms of Retinitis Pigmentosa by Editing Three Rhodopsin-Encoding Genes in Xenopus Laevis Using Crispr/Cas9., Sci Rep 2017                
Most recent:
View All Papers