Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659807

gRNA Name: cfap206 gRNA4
Synonyms: cfap206.L gRNA2
Genomic Target: cfap206

PAM Sequence: gga
Sequence: 5' AGTGGCGTGTAAGGACCCGG 3'



Genomic Target
Identities
genome
gRNA
     
Genomic Alignments Position Identity Strand Target Genomic Target
tropicalis 10.0 Chr5:33418151..33418170 17/20 Sense off-target commd1
Publications
First: The FOXJ1 target Cfap206 is required for sperm motility, mucociliary clearance of the airways and brain development., Development 2020                                        
Most recent:
View All Papers