Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659750

gRNA Name: ift80 gRNA1
Synonyms: ift80 gRNA E8
Genomic Target: ift80

PAM Sequence: CCA
Sequence: 5' GTGTTTGGCTTTTCCAAGGC 3'



Genomic Target tropicalis laevis.L
Identities 20/20 19/20
genome
gRNA
5' GCCTTGGAAAAGCCAAACAC 3'
   ||||||||||||||||||||
3' CGGAACCTTTTCGGTTTGTG 5'
5' TCCTTGGAAAAGCCAAACAC 3'
    |||||||||||||||||||
3' CGGAACCTTTTCGGTTTGTG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5L:111757453..111757472 19/20 Antisense target ift80.L
chr1S:175911596..175911615 18/20 Sense off-target syt4.S
chr9_10L:61757126..61757145 18/20 Antisense off-target dpp4.L
chr3S:52981704..52981723 18/20 Sense off-target cgnl1.S
chr1L:104499424..104499443 17/20 Sense off-target comp.L
chr3S:1174066..1174085 17/20 Antisense off-target krasl.S
chr3L:7144334..7144353 17/20 Antisense off-target hmgxb3.L
chr9_10L:13338682..13338701 17/20 Antisense off-target LOC108700910
chr1S:125988088..125988107 17/20 Antisense off-target LOC108707118 [provisional:lrrc75b]
chr7L:97040313..97040332 16/20 Antisense off-target ttc34.L
chr8S:95153156..95153175 16/20 Antisense off-target igsf9.S
chr3S:99243579..99243598 16/20 Sense off-target pdlim7.S
chr4L:14990741..14990760 16/20 Antisense off-target LOC108713817
chr9_10S:72430853..72430872 16/20 Sense off-target LOC108702412
chr4S:4663696..4663715 16/20 Sense off-target Xetrov90010614m.S
Scaffold34340:376..395 19/20 Sense unknown
chr8L:35395165..35395184 18/20 Sense unknown
chr1L:213572628..213572647 17/20 Antisense unknown
chr3S:101232676..101232695 16/20 Sense unknown
chr8L:113149312..113149331 16/20 Antisense unknown
tropicalis 10.0 Chr5:114825848..114825867 20/20 Antisense ift80
Chr9:72079505..72079524 18/20 Sense dpp4
Chr6:57310270..57310289 18/20 Antisense hecw1
Chr7:59823033..59823052 18/20 Antisense cabp2
Chr2:106280531..106280550 17/20 Antisense frmpd4
Chr3:21450538..21450557 17/20 Sense hmgxb3
Chr8:54590070..54590089 17/20 Antisense LOC116406910
Chr1:208989395..208989414 17/20 Antisense
Chr1:38444961..38444980 17/20 Sense
Chr8:6916171..6916190 17/20 Antisense
Publications
First: Ttc30a affects tubulin modifications in a model for ciliary chondrodysplasia with polycystic kidney disease., Proc Natl Acad Sci U S A 2021                                                    
Most recent:
View All Papers