Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23659731

Morpholino Name: dicer1 MO6
Synonyms: dicer1-TBMO2
Target mRNA: dicer1

Morpholino Type: translation blocking morpholino
Sequence: 5' CATGAGCTGAAGTCCTGCCATGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/23 23/23 22/23
genome
MO
5' GCATGGCAGGCCTTCAGCTCATG 3'
   |||||||||| ||||||||||||
3' CGTACCGTCCTGAAGTCGAGTAC 5'
5' GCATGGCAGGACTTCAGCTCATG 3'
   |||||||||||||||||||||||
3' CGTACCGTCCTGAAGTCGAGTAC 5'
5' GCATGGCAGGCCTTCAGCTCATG 3'
   |||||||||| ||||||||||||
3' CGTACCGTCCTGAAGTCGAGTAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:79500548..79500570 23/23 Sense target dicer1.L
Chr8S:19864847..19864869 22/23 Antisense target dicer1.S
Chr9_10S:18166615..18166637 20/23 Sense off-target cox4i2.S
Chr8L:101585012..101585034 19/23 Antisense off-target srp54.L
Chr8S:2960633..2960655 19/23 Sense off-target srp54.S
Chr3L:118041465..118041487 19/23 Antisense off-target slco3a1.L
Chr7S:79435073..79435095 19/23 Sense unknown
tropicalis 10.0 Chr8:88609163..88609185 22/23 Sense target dicer1
Chr8:109411387..109411409 20/23 Antisense off-target srp54
Chr8:24626184..24626206 20/23 Sense off-target trex2
Chr7:113240427..113240449 19/23 Sense off-target MGC79725
Chr1:194599439..194599461 20/23 Antisense unknown
Publications
First: Bicc1 and Dicer regulate left-right patterning through post-transcriptional control of the Nodal inhibitor Dand5., Nat Commun 2021                                
Most recent:
View All Papers