Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23659730

Morpholino Name: dand5 MO1
Synonyms: Coco1 MO, coco MO, coco1-MO, dand5-TBMO
Target mRNA: dand5

Morpholino Type: translation blocking morpholino
Sequence: 5' CTGGTGGCCTGGAACAACAGCATGT 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 24/25 25/25
genome
MO
5' ACATGCTGCTGTTCCAGGCCACCAG 3'
   |||||||| ||||||||||||||||
3' TGTACGACAACAAGGTCCGGTGGTC 5'
5' ACATGCTGTTGTTCCAGGCCACCAG 3'
   |||||||||||||||||||||||||
3' TGTACGACAACAAGGTCCGGTGGTC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:124818878..124818902 25/25 Sense target dand5.S
Chr3L:149280238..149280262 24/25 Sense target dand5.L
Chr6L:129970060..129970084 21/25 Sense unknown
Publications
First: The left-right axis is regulated by the interplay of Coco, Xnr1 and derrière in Xenopus embryos., Dev Biol 2007                
Most recent: Quantitative analysis of transcriptome dynamics provides novel insights into developmental state transitions., BMC Genomics 2022                                    
View All Papers