Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23659727

Morpholino Name: dand5 MO6
Synonyms: d-tpMO S
Target mRNA: dand5

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGTCGTCAAGTCGTTGGCACTTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 24/25 25/25
genome
MO
5' GAAAGTGCCAACGACTTGACGACTT 3'
   | |||||||||||||||||||||||
3' CCTTCACGGTTGCTGAACTGCTGAA 5'
5' GGAAGTGCCAACGACTTGACGACTT 3'
   |||||||||||||||||||||||||
3' CCTTCACGGTTGCTGAACTGCTGAA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:124816427..124816451 25/25 Sense target dand5.S
tropicalis 10.0 Chr3:139670908..139670932 24/25 Sense target dand5
Publications
First: Bicc1 and Dicer regulate left-right patterning through post-transcriptional control of the Nodal inhibitor Dand5., Nat Commun 2021                                
Most recent:
View All Papers