Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659715

gRNA Name: tm4sf4 gRNA1
Synonyms: tm4sf4-T1
Genomic Target: tm4sf4

PAM Sequence: ggg
Sequence: 5' GGTGGTTGCGCAAAGTGCTT 3'



Genomic Target tropicalis laevis.L
Identities 20/20 20/20
genome
gRNA
5' AAGCACTTTGCGCAACCACC 3'
   ||||||||||||||||||||
3' TTCGTGAAACGCGTTGGTGG 5'
5' AAGCACTTTGCGCAACCACC 3'
   ||||||||||||||||||||
3' TTCGTGAAACGCGTTGGTGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5L:120184612..120184631 20/20 Sense target tm4sf4.L
tropicalis 10.0 Chr5:122343100..122343119 20/20 Sense target tm4sf4
Chr2:114254803..114254822 18/20 Antisense off-target gabrg3
Chr6:84271968..84271987 18/20 Sense off-target c5orf22
Chr2:72839623..72839642 16/20 Sense off-target dcaf6
Chr4:108392883..108392902 16/20 Sense unknown
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers