Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659714

gRNA Name: ptf1a gRNA1
Synonyms: ptf1a/p48
Genomic Target: ptf1a

PAM Sequence: tgg
Sequence: 5' GGAAGACGATGTGGACTTCT 3'



Genomic Target tropicalis laevis.L
Identities 20/20 19/20
genome
gRNA
5' AGAAGTCCACATCGTCTTCC 3'
   ||||||||||||||||||||
3' TCTTCAGGTGTAGCAGAAGG 5'
5' AGAAGTCTACATCGTCTTCC 3'
   ||||||| ||||||||||||
3' TCTTCAGGTGTAGCAGAAGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr6L:23329582..23329601 19/20 Antisense target ptf1a.L
Scaffold72:489569..489588 16/20 Sense unknown
tropicalis 10.0 Chr6:26467756..26467775 20/20 Antisense target ptf1a
Chr6:136758952..136758971 18/20 Antisense off-target eif3h
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers