Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659712

gRNA Name: pdx1 gRNA2
Synonyms: pdx1-T2
Genomic Target: pdx1

PAM Sequence: tgg
Sequence: 5' GGTGAGGGATCCCTGGGTCA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 19/20 18/20 18/20
genome
gRNA
5' TCACCCAGGGATCCCTCACC 3'
   | ||||||||||||||||||
3' ACTGGGTCCCTAGGGAGTGG 5'
5' TCACCCAGGGATCCCTCATC 3'
   | |||||||||||||||| |
3' ACTGGGTCCCTAGGGAGTGG 5'
5' TCACCCAGGGATCCCTCATC 3'
   | |||||||||||||||| |
3' ACTGGGTCCCTAGGGAGTGG 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:158779172..158779191 18/20 Sense target pdx1.L
chr2S:138317927..138317946 18/20 Sense target pdx1.S
chr1L:28927136..28927155 17/20 Antisense off-target limch1.L
chr2L:135956857..135956876 16/20 Antisense off-target nr4a1.L
chr2S:117813790..117813809 16/20 Antisense off-target nr4a1.S
chr2S:117813790..117813809 16/20 Antisense off-target Xetrov90006174m.S
chr8S:62650851..62650870 18/20 Sense unknown
chr9_10L:10753265..10753284 18/20 Antisense unknown
Scaffold65288:57..76 17/20 Antisense unknown
chr1L:8090407..8090426 17/20 Sense unknown
chr1L:8113833..8113852 17/20 Sense unknown
chr2L:97299624..97299643 17/20 Sense unknown
tropicalis 10.0 Chr2:155160032..155160051 19/20 Sense target pdx1
Chr7:81210904..81210923 17/20 Sense off-target kmt2a
Chr8:109991167..109991186 17/20 Antisense off-target chrm5
Chr2:135285457..135285476 16/20 Antisense off-target nr4a1
Chr2:86587245..86587264 16/20 Antisense off-target kpna6
Chr2:99223262..99223281 17/20 Sense unknown
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers