Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659711

gRNA Name: pdx1 gRNA1
Synonyms: pdx1-T1
Genomic Target: pdx1

PAM Sequence: tgg
Sequence: 5' GGGCCAGCATTTCATTTTCT 3'



Genomic Target tropicalis
Identities 20/20
genome
gRNA
5' AGAAAATGAAATGCTGGCCC 3'
   ||||||||||||||||||||
3' TCTTTTACTTTACGACCGGG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr1S:16625926..16625945 18/20 Antisense off-target stk32b.S
chr1L:124206417..124206436 17/20 Sense off-target ptprd.L
chr1S:130816979..130816998 17/20 Antisense off-target Xetrov90003056m.S
chr3L:60792871..60792890 16/20 Antisense off-target cped1.L
chr4L:44611953..44611972 16/20 Antisense off-target vat1l.L
chr5L:86533955..86533974 16/20 Sense off-target bach2.L
chr3L:60792871..60792890 16/20 Antisense off-target LOC108710266 [provisional:cped1]
chr2S:107501804..107501823 18/20 Sense unknown
chr4S:99040227..99040246 18/20 Sense unknown
chr6S:72419707..72419726 18/20 Antisense unknown
chr2L:129500220..129500239 17/20 Antisense unknown
chr1L:169712047..169712066 16/20 Sense unknown
chr2L:18962513..18962532 16/20 Antisense unknown
chr4S:90299075..90299094 16/20 Antisense unknown
chr5L:114989782..114989801 16/20 Sense unknown
chr6S:105025285..105025304 16/20 Antisense unknown
tropicalis 10.0 Chr2:155135614..155135633 20/20 Sense target pdx1
Chr2:118100820..118100839 17/20 Antisense off-target fam155a
Chr1:60157398..60157417 16/20 Antisense off-target il15
Chr4:103977984..103978003 16/20 Antisense off-target bcar3
Chr8:67589114..67589133 16/20 Sense off-target mbnl3
Chr2:114154689..114154708 16/20 Sense off-target gabrg3
Chr1:213535050..213535069 16/20 Sense off-target LOC100490503
Chr1:139239351..139239370 18/20 Antisense unknown
Chr10:36153581..36153600 17/20 Antisense unknown
Chr4:123446052..123446071 17/20 Sense unknown
Chr8:91798069..91798088 17/20 Antisense unknown
Chr3:102627525..102627544 16/20 Sense unknown
Chr5:88037053..88037072 16/20 Sense unknown
Chr8:79280029..79280048 16/20 Antisense unknown
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers