Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659710

gRNA Name: pgat gRNA3
Synonyms: pat-T3
Genomic Target: pgat

PAM Sequence: tgg
Sequence: 5' GGCAGCTCTTGGAAGAACAG 3'



Genomic Target tropicalis
Identities 20/20
genome
gRNA
5' CTGTTCTTCCAAGAGCTGCC 3'
   ||||||||||||||||||||
3' GACAAGAAGGTTCTCGACGG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5S:71784474..71784493 18/20 Antisense off-target bckdhb.S
chr2S:145776910..145776929 17/20 Antisense off-target cntn5.S
chr9_10L:2205075..2205094 17/20 Antisense off-target pgap3.L
chr7L:122234271..122234290 16/20 Sense off-target LOC108696880 [provisional:kmt2b]
chr7S:87583982..87584001 16/20 Sense off-target LOC108697287 [provisional:kmt2b]
chr5S:26926076..26926095 18/20 Antisense unknown
chr7S:45724216..45724235 16/20 Sense unknown
tropicalis 10.0 Chr5:138707102..138707121 20/20 Sense target pgat
Chr5:143605430..143605449 17/20 Sense off-target ldah
Chr10:9904702..9904721 17/20 Antisense off-target pgap3
Chr7:72490734..72490753 17/20 Antisense off-target arhgap32
Chr7:128945272..128945291 16/20 Antisense off-target kmt2b
Chr7:70982013..70982032 16/20 Antisense off-target kirrel3
Chr3:114189005..114189024 16/20 Sense unknown
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers