Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659709

gRNA Name: pgat gRNA2
Synonyms: pat-T2
Genomic Target: pgat

PAM Sequence: tgg
Sequence: 5' GGCACATTCTGATGCAGCAG 3'



Genomic Target tropicalis laevis.L
Identities 20/20 18/20
genome
gRNA
5' CTGCTGCATCAGAATGTGCC 3'
   ||||||||||||||||||||
3' GACGACGTAGTCTTACACGG 5'
5' CTGCTGCATCAAAATGTGCG 3'
   ||||||||||| ||||||| 
3' GACGACGTAGTCTTACACGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5L:138645439..138645458 18/20 Sense target pgat.L
chr3S:5842923..5842942 18/20 Antisense off-target erc1.S
chr2S:44986490..44986509 18/20 Sense off-target kdm6a.S
chr3S:93326007..93326026 17/20 Sense off-target mon2.S
chr2L:84925233..84925252 17/20 Antisense off-target LOC108708252
chr2S:156102715..156102734 17/20 Sense off-target LOC108710053
chr4L:143910044..143910063 17/20 Antisense off-target LOC108714735 [provisional:4930452b06rik]
chr1L:188311872..188311891 16/20 Antisense off-target aggf1.L
chr4L:25443338..25443357 16/20 Antisense off-target flrt1.L
chr4L:25443338..25443357 16/20 Antisense off-target macrod1.L
chr1L:193496069..193496088 19/20 Antisense unknown
chr2L:134803350..134803369 17/20 Sense unknown
chr3L:30829381..30829400 17/20 Antisense unknown
chr7S:64442990..64443009 17/20 Antisense unknown
chr3L:38681118..38681137 16/20 Sense unknown
chr5L:110591806..110591825 16/20 Antisense unknown
chr5L:71677440..71677459 16/20 Sense unknown
chr8S:71100258..71100277 16/20 Sense unknown
chr9_10S:51763082..51763101 16/20 Antisense unknown
tropicalis 10.0 Chr5:138707081..138707100 20/20 Sense target pgat
Chr6:9930963..9930982 18/20 Sense off-target arf5
Chr1:124384867..124384886 17/20 Sense off-target nfib
Chr1:118782102..118782121 17/20 Antisense off-target adamtsl1
Chr5:124726883..124726902 16/20 Antisense unknown
Chr7:89221316..89221335 16/20 Sense unknown
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers