Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659708

gRNA Name: pgat gRNA1
Synonyms: pat-T1
Genomic Target: pgat

PAM Sequence: tgg
Sequence: 5' GGCCTGTAAGCAAAACATTT 3'



Genomic Target tropicalis
Identities 20/20
genome
gRNA
5' AAATGTTTTGCTTACAGGCC 3'
   ||||||||||||||||||||
3' TTTACAAAACGAATGTCCGG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:89568719..89568738 19/20 Sense off-target sec16b.L
Scaffold61:253344..253363 17/20 Antisense off-target arl3.L
chr2S:109569116..109569135 17/20 Antisense off-target dach1.S
chr3S:70633195..70633214 17/20 Antisense off-target magi2.S
chr9_10L:2170035..2170054 17/20 Sense off-target erbb2.L
chr5L:53063655..53063674 17/20 Antisense off-target galnt2.L
chr1S:139852774..139852793 17/20 Sense off-target slc12a2.S
chr8L:2605793..2605812 17/20 Antisense off-target cacna1b.L
chr8L:9664965..9664984 16/20 Antisense off-target nek6.L
chr8S:41023989..41024008 16/20 Sense off-target nek6.S
chr1L:195566329..195566348 16/20 Sense off-target mtrex.L
chr8L:3904409..3904428 16/20 Antisense off-target qsox2.L
chr2L:27543081..27543100 16/20 Sense off-target Xelaev18011603m
chr1S:106908898..106908917 18/20 Antisense unknown
chr1S:90712760..90712779 18/20 Antisense unknown
chr1S:95884698..95884717 18/20 Antisense unknown
chr3S:78018753..78018772 18/20 Antisense unknown
chr5S:111568180..111568199 18/20 Sense unknown
chr8S:51126384..51126403 18/20 Sense unknown
chr1S:73080958..73080977 17/20 Sense unknown
chr2S:111994440..111994459 17/20 Sense unknown
chr2S:12031191..12031210 17/20 Antisense unknown
chr2S:57485739..57485758 17/20 Antisense unknown
chr3L:139980453..139980472 17/20 Antisense unknown
chr7S:79657293..79657312 17/20 Sense unknown
chr1L:207370373..207370392 16/20 Sense unknown
chr1S:171148434..171148453 16/20 Sense unknown
chr2S:115991710..115991729 16/20 Antisense unknown
chr9_10S:72177794..72177813 16/20 Sense unknown
tropicalis 10.0 Chr5:138707782..138707801 20/20 Sense target pgat
Chr1:19174128..19174147 18/20 Antisense off-target spon2
Chr5:49099906..49099925 17/20 Sense off-target stxbp5
Chr10:39816466..39816485 17/20 Antisense off-target epb41l1
Chr8:29215773..29215792 16/20 Sense off-target nek6
Chr7:117269039..117269058 16/20 Sense off-target pold1
Chr4:54672733..54672752 18/20 Antisense unknown
Chr1:97248564..97248583 17/20 Antisense unknown
Chr5:87794364..87794383 17/20 Antisense unknown
Chr3:133212272..133212291 16/20 Sense unknown
Chr4:63033377..63033396 16/20 Antisense unknown
Chr6:118144405..118144424 16/20 Sense unknown
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers