Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659707

gRNA Name: hhex gRNA1
Synonyms:
Genomic Target: hhex

PAM Sequence: tgg
Sequence: 5' GGGCTGAGGAGCTGGGGTGC 3'



Genomic Target tropicalis laevis.L
Identities 20/20 19/20
genome
gRNA
5' GCACCCCAGCTCCTCAGCCC 3'
   ||||||||||||||||||||
3' CGTGGGGTCGAGGAGTCGGG 5'
5' GCACCCCAGCTCCTCAGCTC 3'
   |||||||||||||||||| |
3' CGTGGGGTCGAGGAGTCGGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr7L:20398345..20398364 19/20 Sense target hhex.L
chr8S:5512412..5512431 16/20 Sense off-target ltk.S
chr7S:27047961..27047980 16/20 Antisense unknown
chr8L:85905148..85905167 16/20 Sense unknown
tropicalis 10.0 Chr7:25602616..25602635 20/20 Sense hhex
Chr6:28747537..28747556 16/20 Sense rsu1
Chr6:77062564..77062583 16/20 Sense
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers