Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659705

gRNA Name: ets2 gRNA1
Synonyms:
Genomic Target: ets2

PAM Sequence: tgg
Sequence: 5' GGTCTGGACTCTTACTCTCA 3'



Genomic Target tropicalis
Identities 20/20
genome
gRNA
5' TGAGAGTAAGAGTCCAGACC 3'
   ||||||||||||||||||||
3' ACTCTCATTCTCAGGTCTGG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr5L:110413729..110413748 17/20 Antisense off-target lpp.L
Chr9_10S:99654232..99654251 18/20 Sense unknown
tropicalis 10.0 Chr2:11902276..11902295 20/20 Antisense target ets2
Chr6:21863690..21863709 16/20 Sense off-target pard3
Chr3:130839569..130839588 19/20 Sense unknown
Chr3:110590035..110590054 18/20 Antisense unknown
Chr1:121862692..121862711 16/20 Sense unknown
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers