Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659704

gRNA Name: ets1 gRNA3
Synonyms: ets1-T3
Genomic Target: ets1

PAM Sequence: agg
Sequence: 5' GGGTCACGCAGCAATGCTAA 3'



Genomic Target tropicalis
Identities 20/20
genome
gRNA
5' TTAGCATTGCTGCGTGACCC 3'
   ||||||||||||||||||||
3' AATCGTAACGACGCACTGGG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
tropicalis 10.0 Chr7:72040607..72040626 20/20 Sense target ets1
Chr1:152268165..152268184 17/20 Sense off-target LOC116406445
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers