Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659702

gRNA Name: ets1 gRNA1
Synonyms: est1-T1
Genomic Target: ets1

PAM Sequence: GGG
Sequence: 5' GGAGCAGCATTATGTGGCCT 3'



Genomic Target tropicalis laevis.S
Identities 20/20 19/20
genome
gRNA
5' AGGCCACATAATGCTGCTCC 3'
   ||||||||||||||||||||
3' TCCGGTGTATTACGACGAGG 5'
5' AGGGCACATAATGCTGCTCC 3'
   ||| ||||||||||||||||
3' TCCGGTGTATTACGACGAGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr7S:60334165..60334184 19/20 Antisense target ets1.S
Chr3S:130097612..130097631 16/20 Antisense unknown
tropicalis 10.0 Chr7:72044997..72045016 20/20 Antisense target ets1
Chr3:86530797..86530816 17/20 Antisense off-target LOC101732997
Chr5:70507328..70507347 17/20 Sense unknown
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers