Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659701

gRNA Name: cela1.6 gRNA2
Synonyms: elastase -T2
Genomic Target: cela1.6

PAM Sequence: AGG
Sequence: 5' GGTGGTGATGGAGTCCGTTC 3'



Genomic Target tropicalis
Identities 20/20
genome
gRNA
5' GAACGGACTCCATCACCACC 3'
   ||||||||||||||||||||
3' CTTGCCTGAGGTAGTGGTGG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr2L:150032284..150032303 20/20 Antisense off-target cela1.3.L
Chr2L:150017199..150017218 19/20 Antisense off-target cela1.4.L
Chr2L:150043791..150043810 19/20 Antisense off-target cela1.2.L
Chr9_10L:129578651..129578670 18/20 Antisense unknown
Chr9_10L:130421478..130421497 18/20 Sense unknown
Chr7S:42437525..42437544 17/20 Antisense unknown
Chr7L:59871941..59871960 16/20 Sense unknown
tropicalis 10.0 Chr2:142386711..142386730 20/20 Antisense target cela1.6
Chr2:142375768..142375787 20/20 Antisense off-target cela1.4
Chr2:142398836..142398855 20/20 Antisense off-target cela1.2
Chr4:11011669..11011688 16/20 Antisense off-target slc1a2
Chr4:11011690..11011709 16/20 Antisense off-target slc1a2
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers