Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659700

gRNA Name: cela1.6 gRNA1
Synonyms: elastase-T1
Genomic Target: cela1.6

PAM Sequence: TGG
Sequence: 5' GGCAGTTGGTACCATACCTG 3'



Genomic Target tropicalis
Identities 20/20
genome
gRNA
5' CAGGTATGGTACCAACTGCC 3'
   ||||||||||||||||||||
3' GTCCATACCATGGTTGACGG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr2L:150035569..150035588 20/20 Antisense off-target cela1.3.L
Chr2L:150046575..150046594 19/20 Antisense off-target cela1.2.L
Chr2S:98059776..98059795 17/20 Antisense off-target LOC108708949
Chr1L:70819508..70819527 17/20 Sense unknown
Chr3S:35316058..35316077 17/20 Sense unknown
Chr2S:163111795..163111814 16/20 Antisense unknown
tropicalis 10.0 Chr2:142389937..142389956 20/20 Antisense target cela1.6
Chr2:142402678..142402697 20/20 Antisense off-target cela1.2
Chr2:78119492..78119511 18/20 Sense off-target ahdc1
Chr7:131567654..131567673 18/20 Sense unknown
Chr7:131568094..131568113 18/20 Sense unknown
Chr1:109753380..109753399 17/20 Sense unknown
Chr3:94002472..94002491 17/20 Antisense unknown
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers