Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659669

gRNA Name: cep70 gRNA4
Synonyms:
Genomic Target: cep70

Sequence: 5' TGCAGCAGGAGTTGGAGGGCAGG 3'



Genomic Target laevis.L
Identities 23/23
genome
gRNA
5' CCTGCCCTCCAACTCCTGCTGCA 3'
   |||||||||||||||||||||||
3' GGACGGGAGGTTGAGGACGACGT 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10L:55846627..55846649 23/23 Antisense target cep70.L
Chr1L:188527575..188527597 20/23 Antisense off-target slc25a46.L
Chr6S:111718389..111718411 19/23 Sense off-target mmp16.S
Chr8S:31217723..31217745 19/23 Sense off-target LOC108699921
Chr6L:53381073..53381095 20/23 Antisense unknown
Chr9_10L:57073099..57073121 20/23 Antisense unknown
Chr9_10L:57073180..57073202 20/23 Antisense unknown
Chr9_10L:57073396..57073418 20/23 Antisense unknown
Chr9_10L:57073530..57073552 20/23 Antisense unknown
Chr9_10L:57074067..57074089 20/23 Antisense unknown
Chr1L:104826715..104826737 19/23 Sense unknown
Chr1S:66653900..66653922 19/23 Sense unknown
Chr4L:104330540..104330562 19/23 Antisense unknown
Chr7L:26859549..26859571 19/23 Antisense unknown
Chr9_10L:57072722..57072744 19/23 Antisense unknown
Chr9_10L:57072776..57072798 19/23 Antisense unknown
Chr9_10L:57073126..57073148 19/23 Antisense unknown
Chr9_10L:57073665..57073687 19/23 Antisense unknown
Chr9_10L:57073907..57073929 19/23 Antisense unknown
Chr9_10L:57073987..57074009 19/23 Antisense unknown
Chr9_10L:57074148..57074170 19/23 Antisense unknown
tropicalis 10.0 Chr8:146163274..146163296 19/23 Antisense off-target gba
Chr6:17620763..17620785 19/23 Sense off-target ube3c
Chr2:108998464..108998486 19/23 Antisense off-target sh3rf3
Chr4:149526325..149526347 20/23 Antisense unknown
Chr4:133805622..133805644 19/23 Antisense unknown
Publications
First: A role for Cep70 in centriole amplification in multiciliated cells., Dev Biol 2021            
Most recent:
View All Papers