Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659668

gRNA Name: cep70 gRNA3
Synonyms:
Genomic Target: cep70

Sequence: 5' GAGATATAAGGTGGCTGATGTGG 3'



Genomic Target laevis.L
Identities 23/23
genome
gRNA
5' CCACATCAGCCACCTTATATCTC 3'
   |||||||||||||||||||||||
3' GGTGTAGTCGGTGGAATATAGAG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10L:55846919..55846941 23/23 Antisense target cep70.L
Chr5S:92891816..92891838 20/23 Antisense off-target xxylt1.S
Chr8S:4583335..4583357 19/23 Antisense off-target sipa1l1.S
Chr2L:91872900..91872922 19/23 Antisense off-target LOC108708254
tropicalis 10.0 Chr5:144863146..144863168 19/23 Sense off-target klhl29
Chr7:126303611..126303633 19/23 Sense off-target LOC116412444
Chr8:66855282..66855304 19/23 Antisense unknown
Publications
First: A role for Cep70 in centriole amplification in multiciliated cells., Dev Biol 2021            
Most recent:
View All Papers