Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659667

gRNA Name: cep70 gRNA2
Synonyms:
Genomic Target: cep70

Sequence: 5' GCCAAAATCCGGGATCTAGAGG 3'



Genomic Target tropicalis laevis.L
Identities 21/22 22/22
genome
gRNA
5' CCTCCAGATCCCGGATTTTGGC 3'
   |||| |||||||||||||||||
3' GGAGATCTAGGGCCTAAAACCG 5'
5' CCTCTAGATCCCGGATTTTGGC 3'
   ||||||||||||||||||||||
3' GGAGATCTAGGGCCTAAAACCG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10L:55849830..55849851 22/22 Antisense target cep70.L
Chr5L:115758706..115758727 19/22 Antisense off-target ndufb5.L
Chr8L:14381266..14381287 18/22 Antisense unknown
tropicalis 10.0 Chr9:90267095..90267116 21/22 Sense target cep70
Publications
First: A role for Cep70 in centriole amplification in multiciliated cells., Dev Biol 2021            
Most recent:
View All Papers