Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659666

gRNA Name: cep70 gRNA1
Synonyms:
Genomic Target: cep70

Sequence: 5' GTTCTTCCTTTGCAGCTGAAGG 3'



Genomic Target laevis.L
Identities 22/22
genome
gRNA
5' CCTTCAGCTGCAAAGGAAGAAC 3'
   ||||||||||||||||||||||
3' GGAAGTCGACGTTTCCTTCTTG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10L:55851152..55851173 22/22 Sense target cep70.L
Chr1S:111684797..111684818 19/22 Sense off-target tek.S
Chr7L:56359279..56359300 19/22 Antisense off-target kcnma1.L
Chr2S:138449883..138449904 19/22 Antisense off-target map3k12.S
Chr5S:110339252..110339273 18/22 Sense off-target clstn2.S
Chr8L:19147000..19147021 18/22 Antisense off-target mvb12b.L
Chr7S:86850714..86850735 18/22 Sense off-target plekhg5.S
Chr2L:33411052..33411073 18/22 Antisense off-target LOC108707439
Chr6L:146104789..146104810 18/22 Antisense off-target LOC108718600
Chr9_10L:123124747..123124768 18/22 Sense off-target LOC108701689
Chr3S:22936221..22936242 19/22 Sense unknown
Chr7S:47497670..47497691 19/22 Sense unknown
Chr8S:21492983..21493004 19/22 Sense unknown
Chr4S:59799488..59799509 18/22 Sense unknown
tropicalis 10.0 Chr7:101919555..101919576 19/22 Sense off-target prdm16
Chr7:102102768..102102789 19/22 Sense off-target prdm16
Chr1:103329985..103330006 19/22 Sense off-target b4galt1l
Chr2:161108477..161108498 18/22 Sense off-target pdgfd
Chr7:42298634..42298655 18/22 Antisense off-target pald1
Chr4:10054063..10054084 18/22 Sense off-target LOC101731157
Chr9:87272512..87272533 19/22 Sense unknown
Publications
First: A role for Cep70 in centriole amplification in multiciliated cells., Dev Biol 2021            
Most recent:
View All Papers