Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659604

gRNA Name: cfap161 gRNA2
Synonyms:
Genomic Target: cfap161

Sequence: 5' AGCAC C ATGTGGGGTCAGTGG 3'



Genomic Target tropicalis laevis.L
Identities 10/23 10/23
genome
gRNA
5' CCACTGACCCCACACGGTGCT 3'
    |     || ||    |||||
3' TGACTGGGGTGTA C CACGA 5'
5' CCACTGACCCCACATGGTGCT 3'
    |     || ||    |||||
3' TGACTGGGGTGTA C CACGA 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr3L:99046589..99046609 21/21 Antisense target cfap161.L
chr1L:162871577..162871597 17/21 Antisense off-target rhof.L
chr2L:78146983..78147003 17/21 Sense off-target atg3.L
chr4L:111399983..111400003 17/21 Sense off-target ddr2.L
chr5S:40803168..40803188 17/21 Antisense off-target grm1.S
chr5S:89712184..89712204 17/21 Antisense off-target gnb4.S
chr6L:54531678..54531698 17/21 Sense off-target tpk1.L
chr7S:46560936..46560956 17/21 Sense off-target st14.S
Scaffold60:648858..648878 17/21 Sense off-target robo3.S
chr1S:10575911..10575931 17/21 Antisense off-target ctbp1.S
chr1S:39252464..39252484 17/21 Sense off-target palld.S
chr2S:95086962..95086982 17/21 Antisense off-target cnga3.S
chr4L:51046415..51046435 17/21 Sense off-target meak7.L
chr4L:52925514..52925534 17/21 Sense off-target plcg2.L
chr5L:31811374..31811394 17/21 Antisense off-target usp34.L
chr5L:45974898..45974918 17/21 Sense off-target ltbp1.L
chr6L:45675072..45675092 17/21 Antisense off-target eomes.L
chr7L:119119980..119120000 17/21 Antisense off-target usp48.L
chr7L:67166387..67166407 17/21 Antisense off-target nfrkb.L
chr8S:28549229..28549249 17/21 Antisense off-target kcnt1.S
chr8S:28549525..28549545 17/21 Sense off-target kcnt1.S
chr1L:65171780..65171800 17/21 Sense off-target papss1.L
chr3L:131421214..131421234 17/21 Sense off-target cdkn2d.L
chr4S:107778655..107778675 17/21 Sense off-target eefsec.S
chr6L:24739106..24739126 17/21 Sense off-target plxdc2.L
chr7S:49025029..49025049 17/21 Sense off-target pknox2.S
chr9_10L:28283814..28283834 17/21 Antisense off-target engase.L
chr1L:112855912..112855932 17/21 Antisense off-target ptgr1.3.L
chr1L:88322534..88322554 17/21 Sense off-target tmprss9.L
chr8L:118611331..118611351 17/21 Antisense off-target myo1e.2.L
chr3S:61155527..61155547 17/21 Sense off-target mapk8ip2.S
chr1L:139475780..139475800 17/21 Sense off-target LOC101027262
chr3L:49399873..49399893 17/21 Antisense off-target LOC108711070
chr4S:22379963..22379983 17/21 Sense off-target LOC108714947
chr5S:121297214..121297234 17/21 Antisense off-target LOC108718253
chr2L:64955077..64955097 17/21 Sense off-target XB22169588.L [provisional]
chr2L:159667196..159667216 17/21 Sense off-target LOC108707568 [provisional:atp8a2]
chr4S:27357146..27357166 17/21 Antisense off-target LOC108714954 [provisional:znf423]
chr6S:105682807..105682827 17/21 Antisense off-target LOC108719745 [provisional:vps13b]
chr9_10L:28112350..28112370 17/21 Sense off-target LOC108701018 [provisional:rbfox3]
Scaffold60:116491..116511 18/21 Sense unknown
chr1S:135168260..135168280 18/21 Sense unknown
chr2L:125320238..125320258 18/21 Antisense unknown
chr2S:149549132..149549152 18/21 Antisense unknown
chr7S:21035614..21035634 18/21 Sense unknown
Scaffold19:7091036..7091056 17/21 Antisense unknown
Scaffold223:16432..16452 17/21 Antisense unknown
Scaffold30:614022..614042 17/21 Sense unknown
Scaffold33:1447242..1447262 17/21 Sense unknown
Scaffold45:63679..63699 17/21 Sense unknown
Scaffold60:985286..985306 17/21 Antisense unknown
Scaffold60:985609..985629 17/21 Sense unknown
Scaffold76:193765..193785 17/21 Sense unknown
chr1L:174669162..174669182 17/21 Sense unknown
chr1L:181538408..181538428 17/21 Sense unknown
chr1L:43148057..43148077 17/21 Sense unknown
chr1L:94762262..94762282 17/21 Antisense unknown
chr1L:99012567..99012587 17/21 Sense unknown
chr1S:124640688..124640708 17/21 Antisense unknown
chr1S:124640755..124640775 17/21 Sense unknown
chr1S:138994476..138994496 17/21 Antisense unknown
chr1S:138994586..138994606 17/21 Sense unknown
chr1S:151749763..151749783 17/21 Sense unknown
chr1S:38835561..38835581 17/21 Sense unknown
chr2L:100103..100123 17/21 Sense unknown
chr2L:12264697..12264717 17/21 Antisense unknown
chr2L:127656920..127656940 17/21 Sense unknown
chr2L:175559760..175559780 17/21 Antisense unknown
chr2L:32235789..32235809 17/21 Antisense unknown
chr2L:69774039..69774059 17/21 Sense unknown
chr2S:11153959..11153979 17/21 Sense unknown
chr2S:132144752..132144772 17/21 Sense unknown
chr2S:1402469..1402489 17/21 Sense unknown
chr2S:158953235..158953255 17/21 Sense unknown
chr2S:48044775..48044795 17/21 Sense unknown
chr2S:64894612..64894632 17/21 Sense unknown
chr2S:71427270..71427290 17/21 Sense unknown
chr2S:73568355..73568375 17/21 Antisense unknown
chr2S:73568486..73568506 17/21 Sense unknown
chr3L:121586176..121586196 17/21 Sense unknown
chr3L:35989470..35989490 17/21 Sense unknown
chr3S:112906340..112906360 17/21 Antisense unknown
chr3S:77522308..77522328 17/21 Sense unknown
chr4L:714631..714651 17/21 Antisense unknown
chr4S:38338479..38338499 17/21 Antisense unknown
chr4S:38338573..38338593 17/21 Sense unknown
chr4S:98047813..98047833 17/21 Sense unknown
chr5L:13055180..13055200 17/21 Antisense unknown
chr5L:82505859..82505879 17/21 Sense unknown
chr5L:96728354..96728374 17/21 Antisense unknown
chr5S:64563462..64563482 17/21 Sense unknown
chr6L:147804569..147804589 17/21 Sense unknown
chr6L:64712233..64712253 17/21 Antisense unknown
chr6S:16497303..16497323 17/21 Antisense unknown
chr6S:17968704..17968724 17/21 Antisense unknown
chr6S:4171091..4171111 17/21 Antisense unknown
chr7L:82704681..82704701 17/21 Antisense unknown
chr7L:95227242..95227262 17/21 Antisense unknown
chr7S:57275726..57275746 17/21 Antisense unknown
chr7S:64305472..64305492 17/21 Antisense unknown
chr7S:65754918..65754938 17/21 Antisense unknown
chr8L:99730039..99730059 17/21 Sense unknown
chr8S:89274976..89274996 17/21 Antisense unknown
chr9_10L:24458454..24458474 17/21 Antisense unknown
tropicalis 10.0 Chr3:108658707..108658727 20/21 Antisense target cfap161
Publications
First: The highly conserved FOXJ1 target CFAP161 is dispensable for motile ciliary function in mouse and Xenopus., Sci Rep 2021                      
Most recent:
View All Papers