Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659603

gRNA Name: cfap161 gRNA1
Synonyms:
Genomic Target: cfap161

Sequence: 5' GGCTCGGGAACTGGAATGAGG 3'



Genomic Target tropicalis laevis.L
Identities 20/21 21/21
genome
gRNA
5' CCTCATTCCAGTTCCCCAGCC 3'
   |||||||||||||||| ||||
3' GGAGTAAGGTCAAGGGCTCGG 5'
5' CCTCATTCCAGTTCCCGAGCC 3'
   |||||||||||||||||||||
3' GGAGTAAGGTCAAGGGCTCGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr3L:114483826..114483846 21/21 Antisense target cfap161.L
Chr3S:27786397..27786417 18/21 Sense off-target polm.S
Chr9_10S:78348497..78348517 17/21 Antisense unknown
tropicalis 10.0 Chr3:108660382..108660402 20/21 Antisense target cfap161
Chr2:80890233..80890253 18/21 Sense unknown
Publications
First: The highly conserved FOXJ1 target CFAP161 is dispensable for motile ciliary function in mouse and Xenopus., Sci Rep 2021                      
Most recent:
View All Papers