Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659546

gRNA Name: cdhr1 gRNA1
Synonyms: cdhr1 L/S exon 7
Genomic Target: cdhr1

Sequence: 5' GGAGTTTTGAGGATAAAAGCGGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 21/23 23/23 22/23
genome
gRNA
5' CCCGCTTTTAATCTCAAAACTCC 3'
   ||||||||||  |||||||||||
3' GGGCGAAAATAGGAGTTTTGAGG 5'
5' CCCGCTTTTATCCTCAAAACTCC 3'
   |||||||||||||||||||||||
3' GGGCGAAAATAGGAGTTTTGAGG 5'
5' CCAGCTTTTATCCTCAAAACTCC 3'
   || ||||||||||||||||||||
3' GGGCGAAAATAGGAGTTTTGAGG 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr7L:52439132..52439154 23/23 Sense target cdhr1.L
Chr7S:42937545..42937567 22/23 Sense target cdhr1.S
Chr3L:93215389..93215411 19/23 Sense off-target kcp.L
Chr4S:29479106..29479128 19/23 Sense off-target nkd1.S
Chr2S:25138027..25138049 19/23 Antisense off-target rcsd1.S
Chr3L:37271730..37271752 20/23 Sense unknown
tropicalis 10.0 Chr7:52473120..52473142 21/23 Sense target cdhr1
Publications
First: Distinct roles for prominin-1 and photoreceptor cadherin in outer segment disc morphogenesis in CRISPR-altered X. laevis., J Cell Sci 2021                            
Most recent:
View All Papers