Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659494

gRNA Name: zbtb21 gRNA2
Synonyms: trop zbtb21 T7
Genomic Target: zbtb21

PAM Sequence: AGG
Sequence: 5' TGTTTGTCAGAACCGAATTGAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 22/23 21/23
genome
gRNA
5' CCTCAATTCGGTTCTGACAAACA 3'
   |||||||||||||||||||||||
3' GGAGTTAAGCCAAGACTGTTTGT 5'
5' CCTCAAGTCGGTTCTGACAAACA 3'
   |||||| ||||||||||||||||
3' GGAGTTAAGCCAAGACTGTTTGT 5'
5' CCTCAAGTCGGCTCTGACAAACA 3'
   |||||| |||| |||||||||||
3' GGAGTTAAGCCAAGACTGTTTGT 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:9011557..9011579 22/23 Sense target zbtb21.L
chr2S:23186972..23186994 21/23 Antisense target zbtb21.S
chr1S:53339421..53339443 19/23 Sense off-target fat4.S
chr8S:22091717..22091739 19/23 Sense off-target ptpn21.S
chr5L:36239519..36239541 21/23 Sense unknown
chr5S:54431575..54431597 19/23 Sense unknown
tropicalis 10.0 Chr2:9601056..9601078 23/23 Sense target zbtb21
Chr1:120059582..120059604 20/23 Sense off-target abca1
Chr4:74984420..74984442 19/23 Antisense off-target fcsk
Publications
First:
Most recent:
View All Papers