Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659493

gRNA Name: zbtb21 gRNA1
Synonyms: trop zbtb21 T1
Genomic Target: zbtb21

PAM Sequence: GGG
Sequence: 5' GTCTAGTTGAAAGACAGTTTGGG 3'



Genomic Target tropicalis
Identities 23/23
genome
gRNA
5' CCCAAACTGTCTTTCAACTAGAC 3'
   |||||||||||||||||||||||
3' GGGTTTGACAGAAAGTTGATCTG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:121016848..121016870 20/23 Sense off-target LOC108708480 [provisional:hs6st3]
chr6L:92975542..92975564 19/23 Antisense off-target LOC108719152
chr5L:119105391..119105413 20/23 Sense unknown
chr6S:29350073..29350095 20/23 Antisense unknown
tropicalis 10.0 Chr2:9600809..9600831 23/23 Antisense target zbtb21
Chr8:43337889..43337911 20/23 Antisense off-target efnb1
Chr4:48374775..48374797 19/23 Antisense off-target mbtps1
Chr5:51318295..51318317 19/23 Antisense off-target ahctf1
Chr3:68137332..68137354 19/23 Sense unknown
Publications
First:
Most recent:
View All Papers