Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659492

gRNA Name: zbtb14 gRNA1
Synonyms: trop zbtb14 T1
Genomic Target: zbtb14

PAM Sequence: AGG
Sequence: 5' CTAAATGAGCAACGCCTAGAAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 22/23 23/23
genome
gRNA
5' CCTTCTAGGCGTTGCTCATTTAG 3'
   |||||||||||||||||||||||
3' GGAAGATCCGCAACGAGTAAATC 5'
5' CCTTCTAGGCGCTGCTCATTTAG 3'
   ||||||||||| |||||||||||
3' GGAAGATCCGCAACGAGTAAATC 5'
5' CCTTCTAGGCGTTGCTCATTTAG 3'
   |||||||||||||||||||||||
3' GGAAGATCCGCAACGAGTAAATC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr6S:92621172..92621194 23/23 Sense target zbtb14.S
Chr6L:113106547..113106569 22/23 Sense target zbtb14.L
Chr5L:46850219..46850241 19/23 Sense off-target ttc27.L
Chr4L:29732833..29732855 19/23 Antisense off-target b4gat1.L
tropicalis 10.0 Chr6:106441184..106441206 23/23 Sense target zbtb14
Chr2:12395129..12395151 19/23 Sense off-target kcnj6
Chr2:12395381..12395403 19/23 Sense off-target kcnj6
Chr9:75863797..75863819 19/23 Sense unknown
Publications
First:
Most recent:
View All Papers