Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659491

gRNA Name: zeb2 gRNA1
Synonyms: trop zeb2 T9
Genomic Target: zeb2

PAM Sequence: CGG
Sequence: 5' GTACTTGCAGCGGACTGATACGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 21/23 22/23
genome
gRNA
5' CCGTATCAGTCCGCTGCAAGTAC 3'
   |||||||||||||||||||||||
3' GGCATAGTCAGGCGACGTTCATG 5'
5' CTGTATCACTCCGCTGCAAGTAC 3'
   | |||||| ||||||||||||||
3' GGCATAGTCAGGCGACGTTCATG 5'
5' CCGTATCACTCCGCTGCAAGTAC 3'
   |||||||| ||||||||||||||
3' GGCATAGTCAGGCGACGTTCATG 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr9_10S:51237152..51237174 22/23 Antisense target zeb2.S
chr9_10L:55959584..55959606 21/23 Antisense target zeb2.L
chr1L:173632273..173632295 19/23 Sense off-target LOC108717343 [provisional:tmed7-ticam2]
tropicalis 10.0 Chr9:78623460..78623482 23/23 Sense target zeb2
Chr3:31593576..31593598 19/23 Antisense off-target ankhd1
Publications
First:
Most recent:
View All Papers