Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659490

gRNA Name: ywhaz gRNA1
Synonyms: trop ywhaz T3
Genomic Target: ywhaz

PAM Sequence: AGG
Sequence: 5' AGTAGCTTCTGGCGACGCAAAGG 3'



Genomic Target tropicalis
Identities 23/23
genome
gRNA
5' CCTTTGCGTCGCCAGAAGCTACT 3'
   |||||||||||||||||||||||
3' GGAAACGCAGCGGTCTTCGATGA 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
tropicalis 10.0 Chr6:130815675..130815697 23/23 Antisense target ywhaz
Publications
First:
Most recent:
View All Papers