Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659489

gRNA Name: wwox gRNA1
Synonyms: trop wwox T2
Genomic Target: wwox

PAM Sequence: TGG
Sequence: 5' AGTGAGGATGAGATGCCACCTGG 3'



Genomic Target tropicalis
Identities 23/23
genome
gRNA
5' CCAGGTGGCATCTCATCCTCACT 3'
   |||||||||||||||||||||||
3' GGTCCACCGTAGAGTAGGAGTGA 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:44505588..44505610 21/23 Antisense off-target XB1011895.L [provisional]
tropicalis 10.0 Chr4:54450240..54450262 23/23 Antisense target wwox
Chr4:54450240..54450262 23/23 Antisense off-target LOC101733232
Chr6:17583825..17583847 20/23 Sense off-target ube3c
Chr2:148826441..148826463 19/23 Antisense off-target gpd1
Chr3:151513308..151513330 19/23 Sense off-target srrt
Chr5:146351979..146352001 19/23 Sense off-target opn5
Chr1:36965241..36965263 20/23 Sense unknown
Chr5:74553894..74553916 19/23 Antisense unknown
Publications
First:
Most recent:
View All Papers