Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659487

gRNA Name: wt1 gRNA1
Synonyms: trop wt1 T1
Genomic Target: wt1

Sequence: 5' CCCTGTCCGGGAACAGCAGCTGC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 19/23 20/23
genome
gRNA
5' GCAGCTGCTGTTCCCGGACAGGG 3'
   |||||||||||||||||||||||
3' CGTCGACGACAAGGGCCTGTCCC 5'
5' ACAGCTGCTATTCCCGGACAGAC 3'
    |||||||| |||||||||||  
3' CGTCGACGACAAGGGCCTGTCCC 5'
5' ACAGCTGCTGTTCCCGGACAGAC 3'
    ||||||||||||||||||||  
3' CGTCGACGACAAGGGCCTGTCCC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4S:10122273..10122295 20/23 Antisense target wt1.S
chr4L:13096766..13096788 19/23 Sense target wt1.L
chr9_10L:7728483..7728505 20/23 Antisense off-target itgb3.L
chr6L:129159956..129159978 20/23 Sense off-target ankrd46.L
chr6L:129159956..129159978 20/23 Sense off-target LOC108718844
chr7L:50524878..50524900 20/23 Sense off-target Xelaev18035022m
chr9_10L:7728483..7728505 20/23 Antisense off-target XB996620.L [provisional:c1orf198]
chr9_10L:69216305..69216327 19/23 Sense off-target ccdc141.L
tropicalis 10.0 Chr4:18823619..18823641 23/23 Sense target wt1
Chr2:43252675..43252697 19/23 Antisense off-target map3k15
Chr2:67677797..67677819 19/23 Sense off-target plekha6
Publications
First:
Most recent:
View All Papers