Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659486

gRNA Name: wnt11b gRNA3
Synonyms: laevis wnt11b T1
Genomic Target: wnt11b

PAM Sequence: TGG
Sequence: 5' GGATCTGTGGCGCCATCCAGTGG 3'



Genomic Target tropicalis laevis.L
Identities 22/23 23/23
genome
gRNA
5' CCACTGGATGGCGCCACAGAGCC 3'
   |||||||||||||||||||| ||
3' GGTGACCTACCGCGGTGTCTAGG 5'
5' CCACTGGATGGCGCCACAGATCC 3'
   |||||||||||||||||||||||
3' GGTGACCTACCGCGGTGTCTAGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8L:21220561..21220583 23/23 Sense target wnt11b.L
chr8L:74215695..74215717 19/23 Sense off-target traf3.L
chr6L:103757573..103757595 19/23 Sense off-target LOC108719190 [provisional:piezo2]
chr1L:195127580..195127602 19/23 Sense unknown
tropicalis 10.0 Chr8:43798398..43798420 22/23 Sense target wnt11b
Chr8:43791847..43791869 21/23 Antisense off-target LOC493495
Chr5:6203908..6203930 20/23 Antisense off-target alk
Chr5:152249461..152249483 19/23 Antisense off-target elp3
Publications
First:
Most recent:
View All Papers