Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659485

gRNA Name: wnt11b gRNA2
Synonyms: trop wnt11b T3
Genomic Target: wnt11b

PAM Sequence: GGG
Sequence: 5' TGTTCCGGGCACCTCAGCTGGGG 3'



Genomic Target tropicalis laevis.L
Identities 23/23 23/23
genome
gRNA
5' CCCCAGCTGAGGTGCCCGGAACA 3'
   |||||||||||||||||||||||
3' GGGGTCGACTCCACGGGCCTTGT 5'
5' CCCCAGCTGAGGTGCCCGGAACA 3'
   |||||||||||||||||||||||
3' GGGGTCGACTCCACGGGCCTTGT 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8L:21222353..21222375 23/23 Antisense target wnt11b.L
tropicalis 10.0 Chr8:43800423..43800445 23/23 Antisense target wnt11b
Chr8:43789993..43790015 23/23 Sense off-target LOC493495
Publications
First:
Most recent:
View All Papers