Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659483

gRNA Name: wnt11 gRNA1
Synonyms: laevis wnt11 T1
Genomic Target: wnt11

PAM Sequence: TGG
Sequence: 5' GGTGGGTGCCAGCTCGATGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genome
gRNA
5' CCATCGAGCTGGCACCCACC 3'
   ||||||||||||||||||||
3' GGTAGCTCGACCGTGGGTGG 5'
5' CCATCGAGCTGGCACCCACC 3'
   ||||||||||||||||||||
3' GGTAGCTCGACCGTGGGTGG 5'
5' CCATCGAGCTGGCACCCACC 3'
   ||||||||||||||||||||
3' GGTAGCTCGACCGTGGGTGG 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:179094512..179094531 20/20 Sense target wnt11.L
chr2S:154784073..154784092 20/20 Antisense target wnt11.S
chr6S:62468199..62468218 17/20 Sense unknown
tropicalis 10.0 Chr2:173055349..173055368 20/20 Sense target wnt11
Publications
First:
Most recent:
View All Papers