Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659482

gRNA Name: wdpcp gRNA1
Synonyms: laevis wdpcp T1
Genomic Target: wdpcp

PAM Sequence: TGG
Sequence: 5' AAGACCTTGCACTATGTTGGTGG 3'



Genomic Target tropicalis laevis.L
Identities 21/23 23/23
genome
gRNA
5' CCACCAACATAGTGCAAGATCCT 3'
   |||||||||||||||||| || |
3' GGTGGTTGTATCACGTTCCAGAA 5'
5' CCACCAACATAGTGCAAGGTCTT 3'
   |||||||||||||||||||||||
3' GGTGGTTGTATCACGTTCCAGAA 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5L:30830420..30830442 23/23 Sense target wdpcp.L
chr9_10S:14385388..14385410 19/23 Antisense unknown
chr9_10S:91939810..91939832 19/23 Antisense unknown
tropicalis 10.0 Chr5:32826094..32826116 21/23 Sense target wdpcp
Chr3:30671153..30671175 20/23 Sense unknown
Publications
First:
Most recent:
View All Papers