Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659481

gRNA Name: wbp11 gRNA1
Synonyms: trop wbp11 T1
Genomic Target: wbp11

PAM Sequence: GGG
Sequence: 5' AGACCCAAAGCAGATAATCCGGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 22/23 21/23
genome
gRNA
5' CCCGGATTATCTGCTTTGGGTCT 3'
   |||||||||||||||||||||||
3' GGGCCTAATAGACGAAACCCAGA 5'
5' CCCGGATAATCTGCTTTGGGTCT 3'
   ||||||| |||||||||||||||
3' GGGCCTAATAGACGAAACCCAGA 5'
5' CACGGACTATCTGCTTTGGGTCT 3'
   | |||| ||||||||||||||||
3' GGGCCTAATAGACGAAACCCAGA 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:122222896..122222918 22/23 Antisense target wbp11.L
chr4S:100917489..100917511 21/23 Antisense target wbp11.S
Scaffold27:472332..472354 19/23 Sense off-target slc16a3.S
tropicalis 10.0 Chr4:128403134..128403156 23/23 Antisense target wbp11
Publications
First:
Most recent:
View All Papers