Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659479

gRNA Name: vangl2 gRNA
Synonyms: trop vangl2 T5
Genomic Target: vangl2

PAM Sequence: TGG
Sequence: 5' TGCTGCTGCCCCAGATCCTATGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 23/23 23/23
genome
gRNA
5' CCATAGGATCTGGGGCAGCAGCA 3'
   |||||||||||||||||||||||
3' GGTATCCTAGACCCCGTCGTCGT 5'
5' CCATAGGATCTGGGGCAGCAGCA 3'
   |||||||||||||||||||||||
3' GGTATCCTAGACCCCGTCGTCGT 5'
5' CCATAGGATCTGGGGCAGCAGCA 3'
   |||||||||||||||||||||||
3' GGTATCCTAGACCCCGTCGTCGT 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8L:112207708..112207730 23/23 Antisense target vangl2.L
chr8S:94045629..94045651 23/23 Antisense target vangl2.S
Scaffold95:67443..67465 20/23 Antisense off-target ramp3.S
chr1S:127184830..127184852 19/23 Sense off-target ppil2.S
chr7L:120004505..120004527 19/23 Sense off-target arhgef10l.L
chr3S:56746584..56746606 19/23 Sense off-target LOC108712327 [provisional:duoxa1]
chr1S:174493089..174493111 20/23 Antisense unknown
chr2L:4947265..4947287 19/23 Sense unknown
chr3S:119004739..119004761 19/23 Antisense unknown
chr9_10L:63843325..63843347 19/23 Sense unknown
tropicalis 10.0 Chr8:137134076..137134098 23/23 Antisense target vangl2
Chr5:152977871..152977893 19/23 Antisense off-target dnajc27
Chr8:146067692..146067714 19/23 Antisense unknown
Publications
First:
Most recent:
View All Papers