Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659458

gRNA Name: rxrg gRNA1
Synonyms: trop rxrg T2
Genomic Target: rxrg

PAM Sequence: GGG
Sequence: 5' AGGGTGATTGCATCCTCCATGGG 3'



Genomic Target tropicalis laevis.L
Identities 22/23 21/23
genome
gRNA
5' CCCATGGAGGATGCAATCACTCT 3'
   |||||||||||||||||||| ||
3' GGGTACCTCCTACGTTAGTGGGA 5'
5' CCCATGGAAGATGCAATCACTCT 3'
   |||||||| ||||||||||| ||
3' GGGTACCTCCTACGTTAGTGGGA 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:111362265..111362287 21/23 Sense target rxrg.L
chr4S:91716996..91717018 21/23 Sense off-target MGC115510
chr3L:35801336..35801358 19/23 Antisense unknown
chr5S:63031398..63031420 19/23 Antisense unknown
tropicalis 10.0 Chr4:118981384..118981406 22/23 Sense rxrg
Chr2:152266236..152266258 19/23 Antisense
Publications
First:
Most recent:
View All Papers