Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659457

gRNA Name: rxrb gRNA1
Synonyms: trop rxrb T1
Genomic Target: rxrb

Sequence: 5' CCTCTGAGGATGTGAAGCCTCCA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 22/23 23/23
genome
gRNA
5' TGGAGGCTTCACATCCTCAGAGG 3'
   |||||||||||||||||||||||
3' ACCTCCGAAGTGTAGGAGTCTCC 5'
5' TGGAGGCTTCACGTCCTCAGAGG 3'
   |||||||||||| ||||||||||
3' ACCTCCGAAGTGTAGGAGTCTCC 5'
5' TGGAGGCTTCACATCCTCAGAGG 3'
   |||||||||||||||||||||||
3' ACCTCCGAAGTGTAGGAGTCTCC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8S:78244437..78244459 23/23 Sense target rxrb.S
chr8L:50846603..50846625 22/23 Sense target rxrb.L
chr2L:115085282..115085304 21/23 Sense off-target atp11a.L
chr5S:107427647..107427669 20/23 Antisense off-target atg16l1.S
chr1L:143102745..143102767 19/23 Sense off-target p2rx2.L
tropicalis 10.0 Chr8:72288760..72288782 23/23 Sense target rxrb
Chr1:144101223..144101245 19/23 Sense off-target p2rx2
Publications
First:
Most recent:
View All Papers