Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659456

gRNA Name: rxra gRNA2
Synonyms: trop rxra T4
Genomic Target: rxra

Sequence: 5' CCTCAGGACCTATGGCCTCTTTC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 21/23 23/23
genome
gRNA
5' GAAAGAGGCCATAGGTCCTGAGG 3'
   |||||||||||||||||||||||
3' CTTTCTCCGGTATCCAGGACTCC 5'
5' GAAAGAGGCCATAGCTCCGGAGG 3'
   |||||||||||||| ||| ||||
3' CTTTCTCCGGTATCCAGGACTCC 5'
5' GAAAGAGGCCATAGGTCCTGAGG 3'
   |||||||||||||||||||||||
3' CTTTCTCCGGTATCCAGGACTCC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8S:30078276..30078298 23/23 Antisense target rxra.S
chr8L:5287708..5287730 21/23 Antisense target rxra.L
chr7S:65631317..65631339 20/23 Sense unknown
chr6L:49765986..49766008 19/23 Antisense unknown
tropicalis 10.0 Chr8:7940315..7940337 23/23 Antisense rxra
Publications
First:
Most recent:
View All Papers