Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659455

gRNA Name: rxra gRNA1
Synonyms: trop rxra T3
Genomic Target: rxra

Sequence: 5' CCCCCATGAACTCGGTCAGCAGC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 23/23 21/23
genome
gRNA
5' GCTGCTGACCGAGTTCATGGGGG 3'
   |||||||||||||||||||||||
3' CGACGACTGGCTCAAGTACCCCC 5'
5' GCTGCTGACCGAGTTCATGGGGG 3'
   |||||||||||||||||||||||
3' CGACGACTGGCTCAAGTACCCCC 5'
5' GCTGCTGATTGAGTTCATGGGGG 3'
   ||||||||  |||||||||||||
3' CGACGACTGGCTCAAGTACCCCC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8L:5287789..5287811 23/23 Antisense target rxra.L
chr8S:30078357..30078379 21/23 Antisense target rxra.S
chr8L:13776684..13776706 20/23 Antisense unknown
tropicalis 10.0 Chr8:7940396..7940418 23/23 Antisense rxra
Chr4:18459920..18459942 20/23 Antisense hipk3
Publications
First:
Most recent:
View All Papers