Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659454

gRNA Name: runx2 gRNA1
Synonyms: trop runx2 T3
Genomic Target: runx2

Sequence: 5' CCACTGGCGCTGCAACAAGACCC 3'



Genomic Target tropicalis laevis.L
Identities 23/23 23/23
genome
gRNA
5' GGGTCTTGTTGCAGCGCCAGTGG 3'
   |||||||||||||||||||||||
3' CCCAGAACAACGTCGCGGTCACC 5'
5' GGGTCTTGTTGCAGCGCCAGTGG 3'
   |||||||||||||||||||||||
3' CCCAGAACAACGTCGCGGTCACC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5L:148301313..148301335 23/23 Antisense target runx2.L
chr5S:128114720..128114742 23/23 Antisense off-target LOC108718280 [provisional:runx2]
chr2L:87676778..87676800 22/23 Sense off-target runx3.L
chr2S:74047178..74047200 22/23 Sense off-target runx3.S
chr1L:5819897..5819919 19/23 Sense off-target nagk.L
chr2L:12988363..12988385 19/23 Sense off-target runx1.L
Scaffold114:33836..33858 19/23 Sense off-target Xelaev18000148m
chr4S:35018514..35018536 19/23 Sense off-target Xelaev18024829m
chr8L:110560742..110560764 19/23 Sense off-target Xetrov90003880m.L
chr2S:20630600..20630622 19/23 Antisense off-target LOC108709238 [provisional:runx1]
chr9_10L:40210139..40210161 20/23 Antisense unknown
Scaffold113507:123..145 19/23 Sense unknown
chr6L:149405935..149405957 19/23 Sense unknown
tropicalis 10.0 Chr5:147586450..147586472 23/23 Antisense target runx2
Chr2:89815231..89815253 21/23 Sense off-target runx3
Chr10:38690248..38690270 19/23 Antisense off-target jph2
Chr8:142985286..142985308 19/23 Sense off-target lmna
Chr2:13900826..13900848 19/23 Sense off-target runx1
Chr5:153177826..153177848 19/23 Antisense off-target efr3b
Chr8:143070323..143070345 19/23 Sense off-target klhdc9
Chr7:129566752..129566774 19/23 Antisense off-target LOC101730792
Chr2:4291966..4291988 19/23 Antisense unknown
Chr3:3220330..3220352 19/23 Sense unknown
Chr6:10204380..10204402 19/23 Sense unknown
Chr8:132842014..132842036 19/23 Sense unknown
Chr8:132864524..132864546 19/23 Antisense unknown
Chr8:132874159..132874181 19/23 Antisense unknown
Chr8:142414923..142414945 19/23 Sense unknown
Chr9:81931695..81931717 19/23 Sense unknown
Publications
First:
Most recent:
View All Papers