Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659453

gRNA Name: runx1t1 gRNA1
Synonyms: trop runx1t1 T3
Genomic Target: runx1t1

PAM Sequence: AGG
Sequence: 5' GGCAACGCCGTAGCACAGTGAGG 3'



Genomic Target tropicalis laevis.L
Identities 23/23 23/23
genome
gRNA
5' CCTCACTGTGCTACGGCGTTGCC 3'
   |||||||||||||||||||||||
3' GGAGTGACACGATGCCGCAACGG 5'
5' CCTCACTGTGCTACGGCGTTGCC 3'
   |||||||||||||||||||||||
3' GGAGTGACACGATGCCGCAACGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr6L:127583999..127584021 23/23 Sense target runx1t1.L
chr6S:103983383..103983405 23/23 Sense off-target LOC108695382 [provisional:runx1t1]
chr7L:5478049..5478071 19/23 Sense off-target LOC108696029 [provisional:a2ml1]
tropicalis 10.0 Chr6:127011209..127011231 23/23 Sense runx1t1
Publications
First:
Most recent:
View All Papers