Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659452

gRNA Name: runx1 gRNA1
Synonyms: trop runx1 T1
Genomic Target: runx1

PAM Sequence: GGG
Sequence: 5' CCTCCACCACTCTGAGTCCGGGG 3'



Genomic Target tropicalis laevis.L
Identities 23/23 23/23
genome
gRNA
5' CCCCGGACTCAGAGTGGTGGAGG 3'
   |||||||||||||||||||||||
3' GGGGCCTGAGTCTCACCACCTCC 5'
5' CCCCGGACTCAGAGTGGTGGAGG 3'
   |||||||||||||||||||||||
3' GGGGCCTGAGTCTCACCACCTCC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:12988179..12988201 23/23 Sense target runx1.L
chr2S:20630784..20630806 22/23 Antisense off-target LOC108709238 [provisional:runx1]
chr7L:3330965..3330987 19/23 Sense off-target atrnl1.L
tropicalis 10.0 Chr2:13900642..13900664 23/23 Sense target runx1
Publications
First:
Most recent:
View All Papers